PlantDeepSEA

Search Your Result

Task ID : 2867_16177642225564935

Mission Info :

Model: trained based on ATAC-seq data from mutiple tissues of the Maize (Zea mays) variety B73 (with reference genome version AGPv4)

Input: User-submitted sequence

Task: perform "in silico saturated mutagenesis" analysis for the middle 200-bp of the input sequence

Download the predicted results:

seq_16177642225564935.zip

Results:

You can download the predicted results on this page or select one of the sample you would like to display:

The currently selected model was trained using the data "ATAC-seq, bottom part of ~1cm ear, rep1". The distribution of the prediction scores for 956 sequences labeled as open chromatin regions (OCRs) in the test set is shown below. The prediction score (0.0011) of the submitted sequence is at the 0.4% quantile of this distribution, as shown by the red line.

Note: PlantDeepSEA uses sequences of length 1-kb for prediction, when the length is less than 1-kb, N is used to fill in both ends, thus may cause bias in the results. The sequence you submitted is less than 1-kb, so we have added N at both ends.

Sequence used for prediction

The bases shown in the 'in silico saturation mutagenesis map' section are highlighted (with line width: 100 bp).

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

GAGTGATCACTGTTTTTGTGGTTGTTCAGCTTTTACTATCCCTGGGAAAAAAAAGTGTCAGCAGTAATCTACTTTGAGTAGTGTTTCCATAGAAAACAAA

ACTGCGCATGCGCGCGCTGAGTGTGGTCCTTCTCTTTTAATTACTACTGCGTGGTGTGTGTGTGCTGCCAACAGTAGTAACCATCTGGCACCTCCCTATA

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

in silico saturated mutagenesis map

In the heatmap, each row represents mutations in the corresponding nucleotide, each column represents a position in the sequence. The color of the heatmap presents the predicted change in probability that an allele belongs to open chromatin. The loss score refers to the maximum decrease in probability that an allele belongs to open chromatin compared to the reference nucleotide in all mutations at each site. And the gain score refers to the maximum increase.

Tip: You can drag the graph to view information about other positions.

Regulatory elements identified by FIMO

Detailed Fimo results and the parameters used can be viewed at fimo.html.

For the motifs identified by FIMO (with the P-value < 1e-4), we calculated the average loss and gain values in the in silico saturated mutagenesis map corresponding to the motif regions, which are listed in the table below as 'Loss value' and 'Gain value', respectively.

Motif ID	Name	Start	End	Strand	p-value	q-value	Matched Sequence	Loss value	Gain value
MA0565.1	FUS3	103	111	+	2.23e-06	4.28e-04	CGCATGCGC	7.35e-06	3.12e-05
MA0565.1	FUS3	102	110	-	2.23e-06	4.28e-04	CGCATGCGC	1.23e-05	3.05e-05
MP00028	AT1G09770	111	121	-	3.21e-06	1.22e-03	CACTCAGCGCG	2.48e-05	2.47e-05
MA0579.1	CDC5	111	121	-	3.21e-06	1.22e-03	CACTCAGCGCG	2.48e-05	2.47e-05
MP00046	AT5G39660	47	56	+	9.54e-06	3.55e-03	AAAAAAGTGT	2.48e-05	9.31e-06
MA0973.1	CDF2	47	56	+	9.54e-06	3.55e-03	AAAAAAGTGT	2.48e-05	9.31e-06
MP00139	AT1G13260	166	182	-	1.64e-05	5.67e-03	ATGGTTACTACTGTTGG	5.90e-06	1.01e-05
MP00354	AT3G13040	88	96	+	1.79e-05	6.51e-03	TAGAAAACA	1.07e-06	2.22e-05
MP00180	AT1G34670	10	30	+	1.99e-05	6.77e-03	GTTTTTGTGGTTGTTCAGCTT	5.32e-06	1.35e-05
MA0977.1	DOF2.5	48	55	+	2.18e-05	8.19e-03	AAAAAGTG	2.27e-05	1.20e-05
MP00394	AT3G47500	41	59	+	2.53e-05	8.94e-03	TGGGAAAAAAAAGTGTCAG	1.99e-05	6.93e-06
MP00596	AT5G67300	167	185	-	3.04e-05	1.04e-02	CAGATGGTTACTACTGTTG	6.56e-06	9.15e-06
MA1412.1	TSAR2	107	116	+	3.10e-05	5.37e-03	TGCGCGCGCT	1.14e-05	2.22e-05
MA1412.1	TSAR2	107	116	-	3.19e-05	5.37e-03	AGCGCGCGCA	1.14e-05	2.22e-05
MA0989.1	PHYPADRAFT_153324	47	55	+	3.85e-05	1.46e-02	AAAAAAGTG	2.32e-05	1.05e-05
MA0974.1	CDF3	48	56	+	3.96e-05	1.48e-02	AAAAAGTGT	2.45e-05	1.05e-05
MP00062	AT3G15030	121	128	-	4.21e-05	1.59e-02	AGGACCAC	5.64e-05	1.49e-05
MA1035.1	TCP4	121	128	-	4.21e-05	1.59e-02	AGGACCAC	5.64e-05	1.49e-05
MP00254	AT2G01940	86	100	+	4.81e-05	1.70e-02	CATAGAAAACAAAAC	5.12e-06	2.45e-05
MA1159.1	SGR5	86	100	+	4.81e-05	1.69e-02	CATAGAAAACAAAAC	5.12e-06	2.45e-05
MP00427	AT4G01680	15	28	-	5.92e-05	2.13e-02	GCTGAACAACCACA	6.60e-06	1.28e-05
MP00166	AT1G29160	39	59	+	6.11e-05	2.11e-02	CCTGGGAAAAAAAAGTGTCAG	1.88e-05	7.93e-06
MA1279.1	COG1	39	59	+	6.11e-05	2.11e-02	CCTGGGAAAAAAAAGTGTCAG	1.88e-05	7.93e-06
MA1412.1	TSAR2	103	112	+	6.20e-05	5.37e-03	CGCATGCGCG	6.53e-06	3.24e-05
MA1412.1	TSAR2	103	112	-	6.20e-05	5.37e-03	CGCGCATGCG	6.53e-06	3.24e-05
MA0581.1	LEC2	100	110	-	6.56e-05	2.47e-02	CGCATGCGCAG	1.82e-05	2.59e-05
MP00403	AT3G50700	85	99	+	6.66e-05	2.19e-02	CCATAGAAAACAAAA	5.12e-06	2.41e-05
MA1373.1	IDD2	85	99	+	6.66e-05	2.23e-02	CCATAGAAAACAAAA	5.12e-06	2.41e-05
MP00596	AT5G67300	4	22	+	7.10e-05	1.22e-02	ATCACTGTTTTTGTGGTTG	5.65e-06	9.92e-06
MA1412.1	TSAR2	101	110	+	7.26e-05	5.37e-03	TGCGCATGCG	1.50e-05	2.88e-05
MP00330	AT3G03660	133	143	+	7.71e-05	2.93e-02	TTTTAATTACT	1.13e-05	9.22e-06
MP00008	496250	121	128	-	7.79e-05	2.90e-02	AGGACCAC	5.64e-05	1.49e-05
MA1096.1	ARALYDRAFT_496250	121	128	-	7.79e-05	2.87e-02	AGGACCAC	5.64e-05	1.49e-05
MP00177	AT1G33240	28	37	-	8.61e-05	3.16e-02	ATAGTAAAAG	4.61e-06	1.80e-05
MP00661	Pp3c1_6880	106	115	-	8.62e-05	3.17e-02	GCGCGCGCAT	1.03e-05	2.46e-05
MP00192	AT1G49480	87	101	+	8.85e-05	2.94e-02	ATAGAAAACAAAACT	8.10e-06	2.31e-05
MP00268	AT2G18350	132	146	-	9.24e-05	3.33e-02	AGTAGTAATTAAAAG	1.44e-05	1.14e-05
MA1330.1	ATHB24	132	146	-	9.24e-05	3.33e-02	AGTAGTAATTAAAAG	1.44e-05	1.14e-05
MP00327	AT3G02940	16	33	+	9.61e-05	3.37e-02	GTGGTTGTTCAGCTTTTA	5.27e-06	1.30e-05
MA0982.1	DOF2.4	48	54	+	9.66e-05	3.62e-02	AAAAAGT	2.64e-05	7.27e-06
MP00169	AT1G30210	120	131	-	9.76e-05	3.64e-02	AGAAGGACCACA	4.40e-05	1.76e-05
MA1286.1	TCP24	120	131	-	9.76e-05	3.65e-02	AGAAGGACCACA	4.40e-05	1.76e-05