PlantDeepSEA

Search Your Result

Task ID : 2868_1617764237554985

Mission Info :

Model: trained based on ATAC-seq data from mutiple tissues of the Maize (Zea mays) variety B73 (with reference genome version AGPv4)

Input: User-submitted sequence

Task: perform "in silico saturated mutagenesis" analysis for the middle 200-bp of the input sequence

Download the predicted results:

seq_1617764237554985.zip

Results:

You can download the predicted results on this page or select one of the sample you would like to display:

The currently selected model was trained using the data "ATAC-seq, bottom part of ~1cm ear, rep1". The distribution of the prediction scores for 956 sequences labeled as open chromatin regions (OCRs) in the test set is shown below. The prediction score (0.001) of the submitted sequence is at the 0.4% quantile of this distribution, as shown by the red line.

Note: PlantDeepSEA uses sequences of length 1-kb for prediction, when the length is less than 1-kb, N is used to fill in both ends, thus may cause bias in the results. The sequence you submitted is less than 1-kb, so we have added N at both ends.

Sequence used for prediction

The bases shown in the 'in silico saturation mutagenesis map' section are highlighted (with line width: 100 bp).

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

GAGAGTGATCACTGTTTTTGTGGTTGTTCAGCTTTTACTATCCCTGGGAAAAAAAAGTGTCAGCAGTAATCTACTTTGAGTAGTGTTTCCATAGAAAACA

AAACTGCGCATGCGCGCGCTGAGTGGTCCTTCTCTTTTAATTACTACTGTGTGGTGTGTGTGCTGCCAACAGTAGTAACCATCTGGCACCTCCCTATATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

in silico saturated mutagenesis map

In the heatmap, each row represents mutations in the corresponding nucleotide, each column represents a position in the sequence. The color of the heatmap presents the predicted change in probability that an allele belongs to open chromatin. The loss score refers to the maximum decrease in probability that an allele belongs to open chromatin compared to the reference nucleotide in all mutations at each site. And the gain score refers to the maximum increase.

Tip: You can drag the graph to view information about other positions.

Regulatory elements identified by FIMO

Detailed Fimo results and the parameters used can be viewed at fimo.html.

For the motifs identified by FIMO (with the P-value < 1e-4), we calculated the average loss and gain values in the in silico saturated mutagenesis map corresponding to the motif regions, which are listed in the table below as 'Loss value' and 'Gain value', respectively.

Motif ID	Name	Start	End	Strand	p-value	q-value	Matched Sequence	Loss value	Gain value
MA0565.1	FUS3	105	113	+	2.23e-06	4.16e-04	CGCATGCGC	7.15e-06	3.67e-05
MA0565.1	FUS3	104	112	-	2.23e-06	4.16e-04	CGCATGCGC	9.44e-06	3.60e-05
MP00028	AT1G09770	113	123	-	3.21e-06	1.22e-03	CACTCAGCGCG	2.93e-05	1.47e-05
MA0579.1	CDC5	113	123	-	3.21e-06	1.22e-03	CACTCAGCGCG	2.93e-05	1.47e-05
MP00046	AT5G39660	49	58	+	9.54e-06	3.53e-03	AAAAAAGTGT	2.31e-05	6.53e-06
MA0973.1	CDF2	49	58	+	9.54e-06	3.53e-03	AAAAAAGTGT	2.31e-05	6.53e-06
MP00139	AT1G13260	164	180	-	1.64e-05	5.71e-03	ATGGTTACTACTGTTGG	5.50e-06	1.45e-05
MP00354	AT3G13040	90	98	+	1.79e-05	6.53e-03	TAGAAAACA	1.36e-06	2.29e-05
MP00180	AT1G34670	12	32	+	1.99e-05	6.71e-03	GTTTTTGTGGTTGTTCAGCTT	7.76e-06	1.37e-05
MA0977.1	DOF2.5	50	57	+	2.18e-05	8.16e-03	AAAAAGTG	2.16e-05	8.40e-06
MP00394	AT3G47500	43	61	+	2.53e-05	8.94e-03	TGGGAAAAAAAAGTGTCAG	2.01e-05	4.93e-06
MP00596	AT5G67300	165	183	-	3.04e-05	1.02e-02	CAGATGGTTACTACTGTTG	5.67e-06	1.30e-05
MA1412.1	TSAR2	109	118	+	3.10e-05	5.40e-03	TGCGCGCGCT	6.79e-06	2.58e-05
MA1412.1	TSAR2	109	118	-	3.19e-05	5.40e-03	AGCGCGCGCA	6.79e-06	2.58e-05
MA0989.1	PHYPADRAFT_153324	49	57	+	3.85e-05	1.45e-02	AAAAAAGTG	2.26e-05	7.35e-06
MA0974.1	CDF3	50	58	+	3.96e-05	1.48e-02	AAAAAGTGT	2.23e-05	7.35e-06
MP00062	AT3G15030	121	128	-	4.21e-05	1.59e-02	AGGACCAC	4.89e-05	2.02e-05
MA1035.1	TCP4	121	128	-	4.21e-05	1.60e-02	AGGACCAC	4.89e-05	2.02e-05
MP00254	AT2G01940	88	102	+	4.81e-05	1.68e-02	CATAGAAAACAAAAC	5.59e-06	2.59e-05
MA1159.1	SGR5	88	102	+	4.81e-05	1.68e-02	CATAGAAAACAAAAC	5.59e-06	2.59e-05
MP00427	AT4G01680	17	30	-	5.92e-05	2.15e-02	GCTGAACAACCACA	1.06e-05	1.22e-05
MP00166	AT1G29160	41	61	+	6.11e-05	2.13e-02	CCTGGGAAAAAAAAGTGTCAG	1.89e-05	6.28e-06
MA1279.1	COG1	41	61	+	6.11e-05	2.13e-02	CCTGGGAAAAAAAAGTGTCAG	1.89e-05	6.28e-06
MA1412.1	TSAR2	105	114	+	6.20e-05	5.40e-03	CGCATGCGCG	6.35e-06	3.69e-05
MA1412.1	TSAR2	105	114	-	6.20e-05	5.40e-03	CGCGCATGCG	6.35e-06	3.69e-05
MA0581.1	LEC2	102	112	-	6.56e-05	2.49e-02	CGCATGCGCAG	1.45e-05	3.13e-05
MP00403	AT3G50700	87	101	+	6.66e-05	2.21e-02	CCATAGAAAACAAAA	5.89e-06	2.49e-05
MA1373.1	IDD2	87	101	+	6.66e-05	2.22e-02	CCATAGAAAACAAAA	5.89e-06	2.49e-05
MP00596	AT5G67300	6	24	+	7.10e-05	1.19e-02	ATCACTGTTTTTGTGGTTG	6.65e-06	1.15e-05
MA1412.1	TSAR2	103	112	+	7.26e-05	5.40e-03	TGCGCATGCG	1.11e-05	3.48e-05
MP00330	AT3G03660	133	143	+	7.71e-05	2.91e-02	TTTTAATTACT	6.37e-06	9.67e-06
MP00008	496250	121	128	-	7.79e-05	2.97e-02	AGGACCAC	4.89e-05	2.02e-05
MA1096.1	ARALYDRAFT_496250	121	128	-	7.79e-05	2.90e-02	AGGACCAC	4.89e-05	2.02e-05
MP00407	AT3G55370	128	148	+	8.23e-05	2.80e-02	TTCTCTTTTAATTACTACTGT	1.02e-05	1.10e-05
MA1274.1	OBP3	128	148	+	8.23e-05	2.80e-02	TTCTCTTTTAATTACTACTGT	1.02e-05	1.10e-05
MP00177	AT1G33240	30	39	-	8.61e-05	3.14e-02	ATAGTAAAAG	7.38e-06	1.27e-05
MP00661	Pp3c1_6880	108	117	-	8.62e-05	3.27e-02	GCGCGCGCAT	6.14e-06	3.03e-05
MP00192	AT1G49480	89	103	+	8.85e-05	2.90e-02	ATAGAAAACAAAACT	7.76e-06	2.42e-05
MP00268	AT2G18350	132	146	-	9.24e-05	3.32e-02	AGTAGTAATTAAAAG	8.28e-06	1.03e-05
MA1330.1	ATHB24	132	146	-	9.24e-05	3.32e-02	AGTAGTAATTAAAAG	8.28e-06	1.03e-05
MP00327	AT3G02940	18	35	+	9.61e-05	3.35e-02	GTGGTTGTTCAGCTTTTA	8.74e-06	1.06e-05
MA0982.1	DOF2.4	50	56	+	9.66e-05	3.59e-02	AAAAAGT	2.53e-05	7.33e-06